The Technology
The method of automated DNA Sequencing, utilizes the BigDye Terminator cycle sequencing chemistry from Applied Biosystems (ABI). The samples are sequenced by the 96-capillary 3730xl DNA Analyzer with ABI’s Data collection and Sequence Analysis software.
Free software for viewing the sequencing data – “Sequence Scanner 2” (http://resource.thermofisher.com/page/WE28396_2/)
The following DNA sequencing services are offered:
- Full price Sequencing:
Customers submit samples and primers separately.
Samples in Eppendorf tubes (so we can measure the template concentration) or arranged in strips or plates (mostly for PCR products cleaned by ExoSAP ). Sequencing can be done with in-house DNA sequencing primers or specific sequencing primers provided by the customer.
In this option we will mix DNA, primer, and sequencing reagents, perform the cycling reaction, purify, sequence, analyze, check the outcome and repeat the sequence in case of obvious problem or according to customer request. Customers will receive via email the complete unedited/edited sequence, as will be agreed with each customer.
- Reduced price Sequencing:
Customers submit a mixture of template and primer already “Ready-To-Go” (RTG).
We will mix with the sequencing reagents, perform the cycling reaction, purify, sequence, and analyze the samples. Customers will receive the complete unedited sequence. In this option we will not check the outcome and will not repeat.
- Run-only Sequencing :
Customers submit sequencing plates that are ready to be loaded to on the ABI 3730XL. We will sequence and analyze the samples. Customers will receive the complete unedited sequence via email. In this option we will not check the outcome and will not repeat.
Sample submission
All samples should be submitted with Sample Submission Form for DNA Sequencing.
Write the submitter’s name and the name of DNA/primer on the cap of each tube.
DNA requirements:
Volume: 10µl per reaction
Concentration:
|
Plasmid |
75-300 ng/µl |
|
PCR fragment |
5-50 ng/µl |
All samples should be dissolved in double distilled water (DDW)
Difficult Templates
If you are having trouble with difficult templates, such as those with high G+C content, homopolymer regions, secondary structures or siRNA and our standard reaction cannot solve the problem, we can run the reaction with 5% DMSO and Betaine. However, we cannot always sequence these regions effectively. Please mark the right column on the submission form.
Primers requirements:
Volume: 10µl per reaction
Concentration: 2 pmoles/µl (2µM)
Primers should be dissolved in double distilled water (DDW).
18-22 bases with 50-60% GC content. Melting point (Tm)= 50-60°C.
Degenerate primers should be 50 pmoles/µl
Standard Primers available at the DNA sequencing facility:
|
Primer name |
Primer sequence
|
|
T7 |
TAATACGACTCACTATAGGG |
|
T3 |
AATTAACCCTCACTAAAGGG |
|
M13-(-20) forward |
TGTAAAACGACGGCCAGT |
|
M13-Reverse |
GGAAACAGCTATGACCATG |
|
SP6-18mer |
ATTTAGGTGACACTATAG |
|
T7term |
5' - GCT AGT TAT TGC TCA GCG G - 3' |
Instruction for Ready-To-Go mix preparation
RTG-mix should be submitted as 30 ul mixture in tubes/strips/ plates.
In the submission form, RTG-mix should be indicated in the Remarks section.
For more than 8 samples, submission form should be sent both by mail and as printed version.
Please note to list the order of samples in RTG plate by columns (A1 B1 C1 D1 E1 F1 G1 H1 A2 B2 …)
Concentration of template and primers should be adjusted according to the table below.
|
Type of DNA |
DNA |
Primer |
||
|
DNA amount |
Final concentration |
Primer amount |
Final concentration |
|
|
DS Plasmid DNA |
440ng/30μl |
14.7ng/μl |
9pmol/30μl |
0.3μM |
|
PCR Fragments 100-200bp |
12ng/30μl |
0.4ng/μl |
9pmol/30μl |
0.3μM |
|
PCR Fragments 200-500bp |
24ng/30μl |
0.8ng/μl |
9pmol/30μl |
0.3μM |
|
PCR Fragments 500-1000bp |
45ng/30μl |
1.5ng/μl |
9pmol/30μl |
0.3μM |
|
PCR Fragments 1000-1500bp |
66ng/30μl |
2.2ng/μl |
9pmol/30μl |
0.3μM |
|
PCR Fragments 1500-2000bp |
90ng/30μl |
3.0ng/μl |
9pmol/30μl |
0.3μM |
|
PCR Fragments > 2000bp |
110ng/30μl |
3.7ng/μl |
9pmol/30μl |
0.3μM |
|
Exo-Sap treated PCR mix |
1ul of mix |
|
9pmol/30μl |
0.3μM |
Results
Sequence data is sent to the customer in both XXX.ab1 and XXX.seq format via E-mail.
Please note the name given by the software to the samples, and the meaning of its parts:
It includes the number of the run, the position of the sample in the sequencing plate, sender’s name, and the templates and primers designations, as filled in the submission form.
For example:
s1287_05_michal-pgem-T7.ab1.seq
|
Run number |
well number |
Customer's name |
DNA ID |
Primer ID |
Type of file |
|
s1287_ |
05_ |
michal |
pgem- |
T7 |
.seq |